Gene name |
SPBC1718.03 |
Gene ID |
03/G11 |
Gene synonyms/obsolete |
|
Gene product |
nucleolar protein;
hypothetical coiled-coil protein; interacts with RNA
polymerase I |
Entry clone |
Cloned |
ORF length (unspliced) |
444 |
ORF length (spliced) |
|
Entry clone length |
444 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
290A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1718.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGACAGAATGTCCACC |
Rev primer name |
SPBC1718.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTCTGTTCTTTTTCCCCT |
Amino acid length |
147 |
Molecular weight |
16.9 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |