| Gene name |
SPCC1223.05c |
| Gene ID |
01/H11 |
| Gene synonyms/obsolete |
rpl3702; rpl37-2;
rpl37 |
| Gene product |
60S ribosomal protein
L37 |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
336 |
| ORF length (spliced) |
276 |
| Entry clone length |
336 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
9G:T |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1223.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTAAGGGTACTCAATC |
| Rev primer name |
SPCC1223.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAGAGGCAGCAACAGCG |
| Amino acid length |
91 |
| Molecular weight |
10 |
| Isoelectric point (calc.) |
12 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol>nucleus |
| Microscope used for
observation |
DeltaVision |