| Gene name |
SPBCPT2R1.02 |
| Gene ID |
52/E10 |
| Gene synonyms/obsolete |
|
| Gene product |
sequence orphan |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
360 |
| ORF length (spliced) |
|
| Entry clone length |
360 |
| No. of intron |
0 |
| Sequence status |
|
| Sequence results |
|
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPBCPT2R1.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGCATTAATGAACCA |
| Rev primer name |
SPBCPT2R1.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCCCCCCCAATCACCTCTA |
| Amino acid length |
119 |
| Molecular weight |
13 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
|
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
| Localization (YFP) |
Not determined |
| Comments for localization |
|
| Effect of LMB on protein
localization |
Not determined |
| Microscope used for
observation |
|