Gene name |
SPMIT.07 |
Gene ID |
52/D07 |
Gene synonyms/obsolete |
|
Gene product |
atp6, F0-ATPase
subunit 6, similar to S. cerevisiae ATP6 |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
774 |
ORF length (spliced) |
|
Entry clone length |
774 |
No. of intron |
0 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPMIT.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTATTACAAGTCCTTT |
Rev primer name |
SPMIT.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTGAAGGTTTAAACTATCA |
Amino acid length |
|
Molecular weight |
|
Isoelectric point (calc.) |
|
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
|
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
Localization (YFP) |
no expression
clone |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|