| Gene name |
SPBCPT2R1.04c |
| Gene ID |
52/C09 |
| Gene synonyms/obsolete |
|
| Gene product |
DUF999, telomeric
duplication, 4 predicted transmembrane helices, localization
cell surface (predicted), possibly S. pombe specific |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
901 |
| ORF length (spliced) |
843 |
| Entry clone length |
901 |
| No. of intron |
1 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPBCPT2R1.04c.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAATCCAGAAAGCTT |
| Rev primer name |
SPBCPT2R1.04c.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTTTCACAGGAGTAGG |
| Amino acid length |
280 |
| Molecular weight |
31.5 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
|
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|