| Gene name |
SPCC970.11c |
| Gene ID |
52/B10 |
| Gene synonyms/obsolete |
wtf9; wtf2 |
| Gene product |
|
| Entry clone |
Cloned directly into
pDUAL-FFH1 |
| ORF length (unspliced) |
1352 |
| ORF length (spliced) |
1002 |
| Entry clone length |
1352 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC285.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAATAATTACACTTC |
| Rev primer name |
SPCC285.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACTTCGCTTTCGGCCTCC |
| Amino acid length |
333 |
| Molecular weight |
37.4 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
|
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
| Localization (YFP) |
no expression clone
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|