Gene name |
SPAC17G8.01c |
Gene ID |
52/B07 |
Gene synonyms/obsolete |
SPAC6C3.10c |
Gene product |
tRNA ligase |
Entry clone |
Cloned |
ORF length (unspliced) |
2411 |
ORF length (spliced) |
2364 |
Entry clone length |
2364 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC17G8.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTCGTGATCAAAGAGT |
Rev primer name |
SPAC17G8.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTAAACGGGTTCCAGCATT |
Amino acid length |
787 |
Molecular weight |
90.3 |
Isoelectric point (calc.) |
8.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol, partially |
Microscope used for
observation |
Zeiss |