| Gene name |
SPBPB8B6.05c |
| Gene ID |
51/C09 |
| Gene synonyms/obsolete |
SPAPB8B6.05c;
SPAP8B6.05c |
| Gene product |
putative
L-asparaginase; similar to Sp SPAC977.12 and SPAC186.03 and
SPBPB21E7.09 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1071 |
| ORF length (spliced) |
|
| Entry clone length |
1071 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAP8B6.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGGGGATTCATAGTAAC |
| Rev primer name |
SPAP8B6.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTAATGCTGAATAAACCT |
| Amino acid length |
356 |
| Molecular weight |
38 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
a few cytoplasmic
dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |