Gene name |
SPBC1348.02 |
Gene ID |
51/C07 |
Gene synonyms/obsolete |
SPAC1348.02 |
Gene product |
Sp specific families;
B66205; telomeric duplication; possibly Sp specific |
Entry clone |
Cloned# |
ORF length (unspliced) |
1035 |
ORF length (spliced) |
|
Entry clone length |
1035 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1348.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTGACTTTGTAAAATC |
Rev primer name |
SPAC1348.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATCATTTTCTCTTGAGCC |
Amino acid length |
344 |
Molecular weight |
40.1 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |