| Gene name |
SPAPB15E9.01c |
| Gene ID |
51/A08 |
| Gene synonyms/obsolete |
SPAPB18E9.06c |
| Gene product |
hypothetical protein;
possibly Sp specific; GPI anchored protein; glycoprotein; no
apparent Sc ortholog |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
3111 |
| ORF length (spliced) |
|
| Entry clone length |
3111 |
| No. of intron |
0 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAPB15E9.01.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGAAGTTTTTCACTGCTTC |
| Rev primer name |
SPAPB15E9.01.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAAGCAACCAACAAAATTACC |
| Amino acid length |
1036 |
| Molecular weight |
99.4 |
| Isoelectric point (calc.) |
3.8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no transformant |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|