| Gene name |
SPBC1348.14c |
| Gene ID |
50/H01 |
| Gene synonyms/obsolete |
SPAC1348.14c;
SPAPB8B6.01c; SPAC1348.14; SPAP8B6.01c |
| Gene product |
hexose transporter;
ght7?; similar to Sp GHT1 and GHT2 and GHT4 and GHT5 and GHT6
and SPCC548.06C and GHT3 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1557 |
| ORF length (spliced) |
|
| Entry clone length |
1557 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAP8B6.01.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGCGCGATTTTCAATCACG |
| Rev primer name |
SPAP8B6.01.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAAAGACGAGGCTCCCGTTTA |
| Amino acid length |
518 |
| Molecular weight |
57.9 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |