| Gene name |
SPAC977.10 |
| Gene ID |
50/G04 |
| Gene synonyms/obsolete |
sod2 |
| Gene product |
CPA1 sodium ion/proton
antiporter; similar to Sp SPAC3A11.09 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1484 |
| ORF length (spliced) |
1407 |
| Entry clone length |
1484 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
628T:C / 973A:G /
1072T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC977.10.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGGCTGGAGACAACTTGA |
| Rev primer name |
SPAC977.10.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAAACGTAATCTTCCTGTGAC |
| Amino acid length |
468 |
| Molecular weight |
52.1 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
9 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIVFSILTL |
| Localization (YFP) |
periphery with
discontinuity; ambiguous structure |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |