| Gene name |
SPAPB1A10.07c |
| Gene ID |
50/F07 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
TMS membrane protein/ tumour differentially expressed protein
(TDE) domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1375 |
| ORF length (spliced) |
1326 |
| Entry clone length |
1375 |
| No. of intron |
1 |
| Sequence status |
Partially
sequenced |
| Sequence results |
#Low sequence
quality |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB1A10.07.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGGTGCGGTTTTATCTAT |
| Rev primer name |
SPAPB1A10.07.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAAATCATGAAGCGATAAGGA |
| Amino acid length |
441 |
| Molecular weight |
49 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFIVYGLML |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |