| Gene name |
SPAC3H5.11 |
| Gene ID |
50/F03 |
| Gene synonyms/obsolete |
|
| Gene product |
NAD/NADH kinase; ATP
dependent; involved in nicotinamide metabolism; similar to Sp
SPAC1B1.02C and SPCC24B10.02C |
| Entry clone |
Cloned#/Sequence
mismatch |
| ORF length (unspliced) |
1358 |
| ORF length (spliced) |
1182 |
| Entry clone length |
1358 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1354T:addition |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC3H5.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGGAATTCGATGATTC |
| Rev primer name |
SPAC3H5.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATTTTGGTTCCACATCAA |
| Amino acid length |
393 |
| Molecular weight |
44.8 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>=cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |