| Gene name |
SPAPB8E5.03 |
| Gene ID |
50/E11 |
| Gene synonyms/obsolete |
mae1 |
| Gene product |
malic acid transport
protein; malate (and other C4 dicarboxylic acids) permease; no
apparent Sc ortholog |
| Entry clone |
Cloned (also cloned in
2004 trial) |
| ORF length (unspliced) |
1317 |
| ORF length (spliced) |
|
| Entry clone length |
1317 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB8E5.03.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGGTGAACTCAAGGAAAT |
| Rev primer name |
SPAPB8E5.03.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAAACGCTTTCATGTTCACTA |
| Amino acid length |
438 |
| Molecular weight |
49.3 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |