| Gene name |
SPBC776.18c |
| Gene ID |
50/D12 |
| Gene synonyms/obsolete |
pmh1 |
| Gene product |
transcription
initiation factor TFIIH subunit; Mcs complex (pers. comm R
Fisher); zinc finger protein; zf-C3HC4 type (RING finger);
ubiquitin ligase (E3) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1220 |
| ORF length (spliced) |
957 |
| Entry clone length |
1220 |
| No. of intron |
5 |
| Sequence status |
Partially
sequenced |
| Sequence results |
#Low sequence
quality |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC776.18.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGACGATGAAGGTGCTAG |
| Rev primer name |
SPBC776.18.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAACTTGCTACTTCAAGTTTT |
| Amino acid length |
318 |
| Molecular weight |
36.6 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |