| Gene name |
SPAPB17E12.11 |
| Gene ID |
50/D10 |
| Gene synonyms/obsolete |
|
| Gene product |
N-oligosaccharyltransferase (gamma subunit); member
of a complex of 8 ER proteins that transfers core
oligosaccharide from dolichol carrier to Asn-X-Ser/Thr motif;
multiple alignment with human n33; OST family |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1201 |
| ORF length (spliced) |
930 |
| Entry clone length |
1201 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAPB17E12.11.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGAATTTCTTCAAAATCCT |
| Rev primer name |
SPAPB17E12.11.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAAATTAGAAGCTTAAATGGA |
| Amino acid length |
309 |
| Molecular weight |
34.9 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |