| Gene name |
SPAC110.03 |
| Gene ID |
50/D07 |
| Gene synonyms/obsolete |
cdc42 |
| Gene product |
cell division control
protein 42 homolog; small GTPase; Rho family; involved in cell
polarity; involved in conjugation; involved in cellular
morphogenesis; involved in endocytosis; involved in the
regulation of vacuole fusion; essential; involved in
septation; regulated by Scd1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1172 |
| ORF length (spliced) |
579 |
| Entry clone length |
1172 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC110.03.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGCCCACCATTAAGTGTGT |
| Rev primer name |
SPAC110.03.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTACAGTACCAAACACTTTGAC |
| Amino acid length |
192 |
| Molecular weight |
21.3 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |