| Gene name |
SPAPB1A10.15 |
| Gene ID |
50/C04 |
| Gene synonyms/obsolete |
|
| Gene product |
Arv1-like family
protein; similar to S. cerevisiae YLR242C; 4 predicted
transmembrane helices; involved in sterol uptake; involved in
sterol distribution; involved in G1/S and G2/M phase
transition (Q9H2C2); involved in sphingolipid metabolism |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1065 |
| ORF length (spliced) |
663 |
| Entry clone length |
1065 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
315A:G / 543A:G /
856T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB1A10.15.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGAAATGCGTCGAATGCGG |
| Rev primer name |
SPAPB1A10.15.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTACAAGGAGTTGATGGTTGAA |
| Amino acid length |
220 |
| Molecular weight |
24.9 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFSNVDALCI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |