| Gene name |
SPAC1805.15c |
| Gene ID |
50/A09 |
| Gene synonyms/obsolete |
pub2 |
| Gene product |
ubiquitin-protein
ligase (E2); HECT domain; WW domain; C2 domain; constitutively
expressed; function overlapping with Pub1p; post-translational
modification, Cys639 can be thiol-ubiquitinated; similar to Sp
SPBC16E9.11C and SPAC11G7.02 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2209 |
| ORF length (spliced) |
2016 |
| Entry clone length |
2209 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1805.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAATATTCGCTTTGA |
| Rev primer name |
SPAC1805.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCCGTACCAAATCCTGCA |
| Amino acid length |
671 |
| Molecular weight |
77.1 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLRSLKPYLLI |
| Localization (YFP) |
periphery;
nucleus>cytosol; cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |