| Gene name |
SPAPB21F2.02 |
| Gene ID |
49/H07 |
| Gene synonyms/obsolete |
|
| Gene product |
similar to A. nidulans
dopA which causes delayed and asynchronous morphogenesis
during asexual reproduction; Sc DOP1 is null-lethal |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5229 |
| ORF length (spliced) |
5064 |
| Entry clone length |
5229 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
370T:C / 1387T:C /
1732A:C / 2703T:C / 2937T:G / 3156G:A / 3266A:G /
3745T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB21F2.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACACTATAATTGGTAC |
| Rev primer name |
SPAPB21F2.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTACTGGAGCCAGCCAGG |
| Amino acid length |
1687 |
| Molecular weight |
192.6 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAFLVKLCLDI/LHAIKKLLPL/LTAKITQLDI/LFLFIRALAL/LWPIVVSELLI/LLDFLTALKL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal |