Gene name |
SPBPJ4664.06 |
Gene ID |
49/H04 |
Gene synonyms/obsolete |
gpt1 |
Gene product |
glycosyl transferase
family 8; induced by stress; non-essential; N-terminal domain
is required for proper folding; no apparent Sc ortholog |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
4347 |
ORF length (spliced) |
|
Entry clone length |
4347 |
No. of intron |
0 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBPJ4664.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGATGGGGCTTTTGGTT |
Rev primer name |
SPBPJ4664.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGTTCGTCCGGAGATGAG |
Amino acid length |
1448 |
Molecular weight |
165.4 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSLQFSLGL/LYSLLEEHLPL/LFLDVLFPLEL |
Localization (YFP) |
no expression
clone |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|