| Gene name |
SPBP22H7.05c |
| Gene ID |
49/G05 |
| Gene synonyms/obsolete |
pi026;
SPACTOKYO_453.08 |
| Gene product |
possibly I TAT-binding
protein homolog; AAA family ATPase; bromodomain protein;
similar to Sp SPAC31G5.19 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3606 |
| ORF length (spliced) |
|
| Entry clone length |
3606 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
3158T:C /
3347T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP22H7.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGCAGAAGGGCCAGATC |
| Rev primer name |
SPBP22H7.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACACCCATATCCTCAAGC |
| Amino acid length |
1201 |
| Molecular weight |
137.3 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
214 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKEMVMLPL/LYPEVFLHLHI/LLKRISFLPI |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |