| Gene name |
SPCPB16A4.01 |
| Gene ID |
49/F06 |
| Gene synonyms/obsolete |
mip1;
SPCC24B10.22 |
| Gene product |
mitochondrial DNA
polymerase gamma, mitochondrial |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3057 |
| ORF length (spliced) |
|
| Entry clone length |
3057 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
366T:C / 1554A:G /
2312T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCPB16A4.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCTACAAAGCTTGTCC |
| Rev primer name |
SPCPB16A4.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTAAAATGCTTGTGCTTTT |
| Amino acid length |
1018 |
| Molecular weight |
116 |
| Isoelectric point (calc.) |
9.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |