| Gene name |
SPBP19A11.03c |
| Gene ID |
49/F03 |
| Gene synonyms/obsolete |
mts4 |
| Gene product |
19S proteasome
(regulatory subunit); interacts physically with Mts2p; PC
repeats; essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2723 |
| ORF length (spliced) |
2676 |
| Entry clone length |
2723 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
403A:G / 716A:G /
1759T:G / 2709G:A / 2713T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP19A11.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTCTAAAGACATTAG |
| Rev primer name |
SPBP19A11.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCGGTCATTTCAATGTCC |
| Amino acid length |
891 |
| Molecular weight |
97.9 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWNVDMGLSL/LSCLAALSL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |