| Gene name |
SPAPB1A10.09 |
| Gene ID |
49/D11 |
| Gene synonyms/obsolete |
|
| Gene product |
microtubule-associated
protein; involved in spindle elongation (anaphase); similar to
human prc1, protein regulating cytokinesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2243 |
| ORF length (spliced) |
2196 |
| Entry clone length |
2243 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1203T:C /
1547T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB1A10.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAACAGTAATGATGGA |
| Rev primer name |
SPAPB1A10.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAGCCTTCTTCTCCCCAT |
| Amino acid length |
731 |
| Molecular weight |
83.1 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPKVQSLLI |
| Localization (YFP) |
microtubules |
| Comments for localization |
only spindle
microtubules? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |