| Gene name |
SPBC11B10.01 |
| Gene ID |
49/C05 |
| Gene synonyms/obsolete |
SPBC32H8.14; pi010;
c11B10.01 |
| Gene product |
glycosyl transferase
family 1; involved in oligosaccharide-PP-dolichol assembly;
alpha-1, 3-mannosyltransferase; human disease associated
(CDG-Ii) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1787 |
| ORF length (spliced) |
1536 |
| Entry clone length |
1787 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
250G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC11B10.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCACAAGAAAATTCGGT |
| Rev primer name |
SPBC11B10.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGATTCGTTAGCTTTGCA |
| Amino acid length |
511 |
| Molecular weight |
57.8 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPSSIFGRLSI/LSTCVPFLLL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica,
Confocal |