Gene name |
SPBPB2B2.01 |
Gene ID |
49/B12 |
Gene synonyms/obsolete |
|
Gene product |
amino acid permease
family; similar to Sp SPAP7G5.06 and SPAC869.11 and SPBC359.01
and SPBC359.01 and meu22 and isp5 |
Entry clone |
Cloned |
ORF length (unspliced) |
1758 |
ORF length (spliced) |
|
Entry clone length |
1758 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
162A:G / 194T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBPB2B2.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGCTTATGTTAGGGA |
Rev primer name |
SPBPB2B2.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCACATCATATCAGATAGC |
Amino acid length |
585 |
Molecular weight |
65.1 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
|
No. of transmembrane domain |
10 |
NLS position (Columbia Univ.
Bioinformatics Center) |
78 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSLFIVSLLI/LVALLILFL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |