| Gene name |
SPBC12C2.10c |
| Gene ID |
48/G08 |
| Gene synonyms/obsolete |
pst1;
SPBC21D10.01c |
| Gene product |
involved in chromatin
silencing; involved in histone deacetylation; sin3 family
corepressor; similar to Sp pst2 (paralog) |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
4706 |
| ORF length (spliced) |
4569 |
| Entry clone length |
4706 |
| No. of intron |
1 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned (3'del:
1st clone/but this clone has another frameshift) |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPBC12C2.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAAAAGACTGGCAAGA |
| Rev primer name |
SPBC12C2.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAGATCATCCTTGGAAGGC |
| Amino acid length |
1522 |
| Molecular weight |
171.4 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|