| Gene name |
SPAC11D3.15 |
| Gene ID |
48/F05 |
| Gene synonyms/obsolete |
|
| Gene product |
oxoprolinase; similar
to Sp SPAC11D3.14c (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3954 |
| ORF length (spliced) |
|
| Entry clone length |
3954 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
191A:G / 2015T:C /
2138T:C / 2315A:G / 2866A:G |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC11D3.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGTCAAAATTCACAT |
| Rev primer name |
SPAC11D3.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTCGTGTGCTGTATTTCC |
| Amino acid length |
1317 |
| Molecular weight |
143.7 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |