| Gene name |
SPBC646.02 |
| Gene ID |
48/F03 |
| Gene synonyms/obsolete |
cwf11 |
| Gene product |
complexed with Cdc5p;
involved in mRNA splicing; no apparent Sc ortholog |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
3855 |
| ORF length (spliced) |
|
| Entry clone length |
3855 |
| No. of intron |
0 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPBC646.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTCTGTATAAAAACAA |
| Rev primer name |
SPBC646.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTCGTATTTAACCTTTTT |
| Amino acid length |
1284 |
| Molecular weight |
148.3 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSLLHELKL/LSRWIHSLLI/LLAIINMSLVL/LCSSIYPLDI |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|