| Gene name |
SPCP31B10.06 |
| Gene ID |
48/D09 |
| Gene synonyms/obsolete |
|
| Gene product |
putative synaptic
vesicle protein; C2 domain; similar to Sp SPCC962.01 |
| Entry clone |
Cloned in 2004
trial/#check (not sequenced before) |
| ORF length (unspliced) |
3567 |
| ORF length (spliced) |
|
| Entry clone length |
3567 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCP31B10.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACTCATAGCGGAGA |
| Rev primer name |
SPCP31B10.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTGAAATCTCGGTTTCA |
| Amino acid length |
1188 |
| Molecular weight |
133.6 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFAYIFSLVI |
| Localization (YFP) |
ER; SPB?;
nucleus>cytosol |
| Comments for localization |
SPB? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |