Gene name |
SPCP31B10.06 |
Gene ID |
48/D09 |
Gene synonyms/obsolete |
|
Gene product |
putative synaptic
vesicle protein; C2 domain; similar to Sp SPCC962.01 |
Entry clone |
Cloned in 2004
trial/#check (not sequenced before) |
ORF length (unspliced) |
3567 |
ORF length (spliced) |
|
Entry clone length |
3567 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCP31B10.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACTCATAGCGGAGA |
Rev primer name |
SPCP31B10.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTGAAATCTCGGTTTCA |
Amino acid length |
1188 |
Molecular weight |
133.6 |
Isoelectric point (calc.) |
5.5 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFAYIFSLVI |
Localization (YFP) |
ER; SPB?;
nucleus>cytosol |
Comments for localization |
SPB? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |