| Gene name |
SPCC576.05 |
| Gene ID |
48/C08 |
| Gene synonyms/obsolete |
|
| Gene product |
leucine permease
transcriptional regulator; SAC3/GANp family; actin
filament-based processes; protein-nucleus export; similar to
Sp SPCC70.06 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3433 |
| ORF length (spliced) |
3075 |
| Entry clone length |
3433 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC576.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAAGCGGAATGAGAC |
| Rev primer name |
SPCC576.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATAAAAAGTTTCAACCTTT |
| Amino acid length |
1024 |
| Molecular weight |
117.6 |
| Isoelectric point (calc.) |
9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
74 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSAVGNLII |
| Localization (YFP) |
nuclear envelope;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |