| Gene name |
SPAC23C11.15 |
| Gene ID |
48/C01 |
| Gene synonyms/obsolete |
pst2 |
| Gene product |
transcriptional
regulator; sin3 family corepressor; similar to Sp pst1
(paralog); essential; involved in retroelement propagation
(required); involved in transcriptional regulation; involved
in chromatin silencing; involved in chromatin
assembly/disassembly; acetyltransferase complex; involved in
histone deacetylation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3352 |
| ORF length (spliced) |
3228 |
| Entry clone length |
3352 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC23C11.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACAAACACTAGCGAT |
| Rev primer name |
SPAC23C11.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGGGATAAATAGTGCATTA |
| Amino acid length |
1075 |
| Molecular weight |
124.8 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LERMPCLTL/LVSGLQAKLCL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |