| Gene name |
SPBP35G2.14 |
| Gene ID |
47/H12 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; RNA-binding protein; rrm RNA recognition motif;
similar to Sp SPBP56F2.08 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3183 |
| ORF length (spliced) |
|
| Entry clone length |
3183 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBP35G2.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAGGATCCATATACGA |
| Rev primer name |
SPBP35G2.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGCACATACCTCAGCCAGC |
| Amino acid length |
1060 |
| Molecular weight |
113.6 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |