| Gene name |
SPCC11E10.08 |
| Gene ID |
47/H06 |
| Gene synonyms/obsolete |
rik1 |
| Gene product |
involved in chromatin
silencing; involved in chromatin silencing at silent mating
type cassettes (sensu Fungi) (required); similar to Sp
SPAC17H9.10C (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3123 |
| ORF length (spliced) |
|
| Entry clone length |
3123 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC11E10.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTTATGTGTTCATTC |
| Rev primer name |
SPCC11E10.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACATAAACTTTGTATTTCC |
| Amino acid length |
1040 |
| Molecular weight |
118.1 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVLLQALKI/LLVFESLFI/LGPIHDLLVL/LIYFQHALKL/LGGLKFLQL/LVPVNGRLIL |
| Localization (YFP) |
SPB?; nucleus |
| Comments for localization |
nuclear dots by over
expression; cytoplasmic dots by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |