| Gene name |
SPBC902.02c |
| Gene ID |
47/G03 |
| Gene synonyms/obsolete |
ctf18; chl12 |
| Gene product |
AAA family ATPase; DNA
replication factor C complex; involved in chromosome
segregation; non-essential; involved in meiotic recombination;
involved in telomere maintenance; involved in sister chromatid
cohesion |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3012 |
| ORF length (spliced) |
2883 |
| Entry clone length |
3012 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
2415A:addition /
2416A:addition |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC902.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCGATTCCAAATGA |
| Rev primer name |
SPBC902.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAAATTCAGAATCTCGTTC |
| Amino acid length |
960 |
| Molecular weight |
108.6 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMNCFHTYLDL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
Leica |