| Gene name |
SPBC14C8.14c |
| Gene ID |
47/E11 |
| Gene synonyms/obsolete |
pol5 |
| Gene product |
DNA polymerase V |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2949 |
| ORF length (spliced) |
2880 |
| Entry clone length |
2949 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
212C:A / 214A:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC14C8.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTACAAAAACACAATT |
| Rev primer name |
SPBC14C8.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGATTTGTCTTTTCATTT |
| Amino acid length |
959 |
| Molecular weight |
109.7 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>nucleus>cytosol |
| Comments for localization |
bright signal |
| Effect of LMB on protein
localization |
changed to:
nucleolus>nucleus |
| Microscope used for
observation |
Leica |