| Gene name |
SPAC18G6.02c |
| Gene ID |
47/D04 |
| Gene synonyms/obsolete |
chp1 |
| Gene product |
chromodomain protein;
involved in centromeric silencing (required); involved in
chromosome segregation (required); interacts genetically with
alpha-tubulin; binds centromeric flanking sequence |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2883 |
| ORF length (spliced) |
|
| Entry clone length |
2883 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC18G6.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTATCTGTTAAACCACT |
| Rev primer name |
SPAC18G6.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTAAACCAATAGCTCTC |
| Amino acid length |
960 |
| Molecular weight |
108.7 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
70/92/118/72 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTKVLSGSLCI/LLELISPFLEI/LTPVNGLDI |
| Localization (YFP) |
SPB; nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |