| Gene name |
SPBC1734.17 |
| Gene ID |
47/C07 |
| Gene synonyms/obsolete |
chs2;
SPBC1709.01 |
| Gene product |
chitin synthase
family; involved in septum formation; similar to Sp
SPAC13G6.12C |
| Entry clone |
Cloned in 2004
trial |
| ORF length (unspliced) |
2828 |
| ORF length (spliced) |
2781 |
| Entry clone length |
2828 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1734.17.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTTTCAGAATCCCAG |
| Rev primer name |
SPBC1734.17.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGATCATTAAAAATGTAA |
| Amino acid length |
926 |
| Molecular weight |
105.5 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVWAVSNLIL |
| Localization (YFP) |
periphery at site of
septum formation |
| Comments for localization |
vacuole by over
expression? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |