| Gene name |
SPAC16C9.06c |
| Gene ID |
47/C03 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in mRNA
catabolism, nonsense-mediated; regulator of nonsense
transcript stability; involved in mRNA decapping (regulation);
RNA dependent ATP helicase; DNA2/NAM7 family |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2778 |
| ORF length (spliced) |
|
| Entry clone length |
2778 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC16C9.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTAGGGCTACAACC |
| Rev primer name |
SPAC16C9.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAACCTAGTAGGTTCGTCG |
| Amino acid length |
925 |
| Molecular weight |
104.5 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
435/437 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSQSLFERLII |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
Leica |