| Gene name |
SPCC4B3.15 |
| Gene ID |
47/B12 |
| Gene synonyms/obsolete |
dmf1; mid1 |
| Gene product |
involved in
cytokinesis (required); involved in septation (required);
expression peaks at M-G1 phase; regulated by PBF transcription
complex; involved in contractile ring positioning;
non-essential; pleckstrin homology domain; no apparent
orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2763 |
| ORF length (spliced) |
|
| Entry clone length |
2763 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC4B3.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGAGCAAGAGTTCTC |
| Rev primer name |
SPCC4B3.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCCATAAAATTCACGTAT |
| Amino acid length |
920 |
| Molecular weight |
102.3 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear envelope;
periphery at mid region of cells (site of septum
formation) |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |