| Gene name |
SPAC17G6.12 |
| Gene ID |
47/B10 |
| Gene synonyms/obsolete |
pcu1 |
| Gene product |
cullin family; SCF
ubiquitin ligase complex; covalent modification of cullin-1 by
the NEDD8 system plays an essential role in the function of
SCF |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2760 |
| ORF length (spliced) |
2304 |
| Entry clone length |
2760 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC17G6.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTACTTTGAATACCAA |
| Rev primer name |
SPAC17G6.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAAGGTAAATGTATTCA |
| Amino acid length |
767 |
| Molecular weight |
89.4 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGEALYNNLVL/LVYDIYTLCL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |