| Gene name |
SPCC1223.01 |
| Gene ID |
46/G09 |
| Gene synonyms/obsolete |
SPCC285.18 |
| Gene product |
zinc finger protein;
zf-C2H2 type; zf-C3HC4 type (RING finger); ubiquitin ligase
(E3) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2302 |
| ORF length (spliced) |
2199 |
| Entry clone length |
2302 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1223.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGCCTTCGGGCCCCAA |
| Rev primer name |
SPCC1223.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCAATGTGAAACAAAACA |
| Amino acid length |
732 |
| Molecular weight |
82.6 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; cytoplasmic
dots by over expression |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol;
cytoplasmic dots by over expression) |
| Microscope used for
observation |
Leica |