Gene name |
SPBC17D11.02c |
Gene ID |
46/E04 |
Gene synonyms/obsolete |
|
Gene product |
C3H4 type zinc finger
protein; zf-C3HC4 type (RING finger); ubiquitin ligase (E3)
|
Entry clone |
Cloned |
ORF length (unspliced) |
2077 |
ORF length (spliced) |
2034 |
Entry clone length |
2077 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC17D11.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTTTATACTATATGT |
Rev primer name |
SPBC17D11.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAATTTTCATCCACAGTT |
Amino acid length |
677 |
Molecular weight |
75.6 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
6 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYVLASLVL |
Localization (YFP) |
large bright dots;
small cytoplasmic dots at periphery |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |