Gene name |
SPCC584.04 |
Gene ID |
46/E02 |
Gene synonyms/obsolete |
sup35 |
Gene product |
omnipotent nonsense
suppressor; EF1 alpha factor-like GTP-binding protein
translation release factor; GTP-binding protein;
GTP/GDP-dependent (class-II) release factor; omnipotent
nonsense suppressor; interacts physically with Sup45p;
complexed with Sup45p; altered form creates prions |
Entry clone |
Cloned |
ORF length (unspliced) |
2072 |
ORF length (spliced) |
1989 |
Entry clone length |
2072 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC584.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTAGTAATCAGCCAAA |
Rev primer name |
SPCC584.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCCAAAATTTTTACGACT |
Amino acid length |
662 |
Molecular weight |
72.5 |
Isoelectric point (calc.) |
8.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
Microscope used for
observation |
Leica |