| Gene name |
SPAC15A10.08 |
| Gene ID |
46/D09 |
| Gene synonyms/obsolete |
ain1 |
| Gene product |
alpha-actinin;
calponin homology (CH) domain; involved in cytokinesis;
involved in actin cytoskeletal organization; involved in
contractile ring assembly; no apparent Sc ortholog |
| Entry clone |
Cloned directly into
pDUAL-FFH1 |
| ORF length (unspliced) |
2057 |
| ORF length (spliced) |
1866 |
| Entry clone length |
2057 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
#check |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC15A10.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGGCAAATCAATGGCA |
| Rev primer name |
SPAC15A10.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACTATTTCTTTGTCTTCG |
| Amino acid length |
621 |
| Molecular weight |
72.4 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LILGLIWTLIL |
| Localization (YFP) |
no expression clone
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|