| Gene name |
SPCC4B3.03c |
| Gene ID |
46/D05 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved hypothetical
protein; involved in mitochondrial maintenance; CBS domain
protein; DUF21 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2040 |
| ORF length (spliced) |
|
| Entry clone length |
2040 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
772A:G / 1432T:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC4B3.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCCTATTGAGAATTCG |
| Rev primer name |
SPCC4B3.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTCTTGCTTTTACCTTTT |
| Amino acid length |
679 |
| Molecular weight |
74.3 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
5 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
668 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLGGVFAGLTI/LVTLHRDLGI |
| Localization (YFP) |
Golgi; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |