Gene name |
SPBC15D4.14 |
Gene ID |
46/C03 |
Gene synonyms/obsolete |
taf73 |
Gene product |
transcription
initiation factor TFIID subunit; WD repeat protein; suppresses
defects in the anaphase-promoting complex; essential;
overexpression suppresses the anaphase blocking mutation cut9;
possible role of WD repeat-containing TAFs in the expression
of genes involved in progression through the M phase of the
cell cycle |
Entry clone |
Cloned |
ORF length (unspliced) |
1985 |
ORF length (spliced) |
1929 |
Entry clone length |
1985 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC15D4.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTCAATCTTCCTACTC |
Rev primer name |
SPBC15D4.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGAAGAGCTTAATGCTAGA |
Amino acid length |
642 |
Molecular weight |
72.2 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRDWIDGTLDL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |