Gene name |
SPAC806.02c |
Gene ID |
46/A10 |
Gene synonyms/obsolete |
|
Gene product |
WD repeat protein; N
terminal is similar to Par A family ATPase; C terminal is
similar to Cia1 family WD repeat domains, this domain
combination does not usually co-occur; gene structure
confirmed; essential |
Entry clone |
Cloned |
ORF length (unspliced) |
1876 |
ORF length (spliced) |
1827 |
Entry clone length |
1876 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC806.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAAATGATATTGAGA |
Rev primer name |
SPAC806.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTAAAGCTCCAAACGCGA |
Amino acid length |
608 |
Molecular weight |
67.6 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |